홈 > 미생물분양 > 검색 및 서비스 신청

검색 및 서비스 신청

도움말
미생물 검색 리스트
미생물명 Trichoderma reesei 종류
KCCM : 35503, ATCC : 26921, IFO : 31329, DSM : 769, NRRL :

▷ History

(Trichoderma viride; Trichoderma longibrachiatum):<< ATCC << B.J. Willey. (ATCC 26921; CCM F-522; DSM 769; IFO 31329; QM 9414).

▷ 특성

Mutant of ATCC 24449, QM 9123. Transformation host(Curr. Genet. 25: 567-570, 1994). Produces hydrolase(FEMS Microbiol. Lett. 23: 227-232, 1984), cellulase(endoglucanase; endo-1,4-beta-glucanase; beta-1,4-glucan-4-glucanohydrolase; Biotechnol. Bioeng. 18: 1751-1760, 1976), paracelsin(Experientia 39: 528-530, 1983; Biomed. Mass Spectrom. 11: 569-582, 1984), acetylesterase(Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987), beta-glucosidase(cellobiase; Acta Biotechnol. 11: 485-494, 1991; Enzyme Microb. Technol. 12: 685-690, 1990; Biochim. Biophys. Acta 1033: 298-304, 1990), endoglucanase III(EIII; Eur. J. Biochem. 173: 179-183, 1988), exo-cellobiohydrolase(endoglucanase I; Biotechnol. Appl. Biochem. 15: 236-246, 1992), alpha-1,2-glucuronidase(Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987), exo-1,4-beta-D-xylosidase(beta-xylosidase; Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987), alpha-L-arabinofuranosidase(alpha-1,3-arabinosidase; Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987), mannan endo-1,4-beta-mannosidase(mannanase; beta-mannanase; Proc. 4th Eur. Congr. Biotechnol. 2: 90, 1987), 17 beta-hydroxysteroid dehydrogenase(FEMS Microbiol. Lett. 78: 49-52, 1992), 20 beta-hydroxysteroid dehydrogenase(FEMS Microbiol. Lett. 78: 49-52, 1992) & endoglucanase-cellobiohydrolase complex(FEMS Microbiol. Lett. 106: 239-243, 1993). Produces extracellular hydrolases(FEMS Microbiol. Lett. 23: 227-232, 1984). Produces 1.5-2.0 times more cellulase on cellulose medium than ATCC 24449 EIII core protein of endoglucanase(Eur. J. Biochem. 173: 179-183, 1988). Ethanol- and polyene-sensitive(J. Biotechnol. 29: 97-108, 1993). Produces pectinase(Biotechnol. Bioeng. 25: 1685, 1983).

▷ 배양정보 - POTATO DEXTROSE AGAR (PDA)

Potato Starch, 4.0 g
Dextrose, 20.0 g
Agar, 15.0 g
Distilled water, 1.0 L



▷ 배양온도 : 24℃

▷ 가격코드 : 77,000원

▷ 염기서열

>KCCM35503_ITS-5.8S rRNA gene partial sequence 20200716
GATCATTACGGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCAAACTCTTTTTTCTCTCCGTCGCGGCTTCCGTCGCGGCTCTGTTTTACCTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTCTGAAATGTGACCTCG

목록

분양신청 Print